View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_253 (Length: 216)
Name: NF20384_high_253
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_253 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 62 - 202
Target Start/End: Complemental strand, 41247190 - 41247050
Alignment:
| Q |
62 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41247190 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacaccgcttcagcactattttctatcttcg |
41247091 |
T |
|
| Q |
162 |
gtgtggggcagtattaaggaacacttgtctactatttcttc |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41247090 |
atgtggggcggtattaaggaacacttgtctactatttcttc |
41247050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 62 - 202
Target Start/End: Complemental strand, 10707783 - 10707643
Alignment:
| Q |
62 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg |
161 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| ||| ||| || | ||||||||||||| ||||| ||||||||||||||||| ||||| | |
|
|
| T |
10707783 |
tgcttggcaattctcaacgggagattcaaaatgggcagggctattgcgacatatatttctcaagcatgacacaccgcttcagcactattttcaatctttg |
10707684 |
T |
|
| Q |
162 |
gtgtggggcagtattaaggaacacttgtctactatttcttc |
202 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||| ||||||| |
|
|
| T |
10707683 |
gtgtggggcggtattaaagaacacttggctactgtttcttc |
10707643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 62 - 202
Target Start/End: Complemental strand, 10921553 - 10921413
Alignment:
| Q |
62 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg |
161 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| ||| ||| || | ||||||||||||| ||||| ||||||||||||||||| ||||| | |
|
|
| T |
10921553 |
tgcttggcaattctcaacgggagattcaaaatgggcagggctattgcgacatatatttctcaagcatgacacaccgcttcagcactattttcaatctttg |
10921454 |
T |
|
| Q |
162 |
gtgtggggcagtattaaggaacacttgtctactatttcttc |
202 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||| ||||||| |
|
|
| T |
10921453 |
gtgtggggcggtattaaagaacacttggctactgtttcttc |
10921413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University