View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_261 (Length: 205)
Name: NF20384_high_261
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_261 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 44160587 - 44160758
Alignment:
| Q |
15 |
cacagagacaaaataatgtgaggcaacctacacatcataaaaaatcaaaagcatgaaactaagctggtgtttatttgaattgatggtaagtttaggtaat |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44160587 |
cacagggacaaaataatgtgaggcaacctacacatgataaaaaatcaaaagcatgaaactaagctagtgtttatttgaattgatggtaagtttaggtaat |
44160686 |
T |
|
| Q |
115 |
atgttgttgaaaccctaaattaaactttataatatatatttaacttttgcagaaattacggcagtgcaccgt |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44160687 |
atgttggtgaaaccctaaattaaactttataatatatatttaacttttgcagaaattacggcagtgcaccgt |
44160758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University