View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_29 (Length: 532)
Name: NF20384_high_29
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 179
Target Start/End: Original strand, 51387519 - 51387587
Alignment:
| Q |
111 |
gatgtcaagttcaaatcacnnnnnnnnacggcaaaacaaatcctcactaaatcactttataatcacatt |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
51387519 |
gatgtcaagttcaaatcacttttttttacggcaaaaccaatcctcactagatcactttataatcacatt |
51387587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 51387417 - 51387452
Alignment:
| Q |
9 |
atgaaatgagaactcacatcaaaaaatataaaatca |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51387417 |
atgaaatgagaactcacatcaaaaaatataaaatca |
51387452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University