View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_95 (Length: 379)
Name: NF20384_high_95
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_95 |
 | |
|
| [»] scaffold0029 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 18 - 367
Target Start/End: Original strand, 35412275 - 35412624
Alignment:
| Q |
18 |
taaaatgctgtgaatattacttaagttttatccatgataaacatacaacagctactgcaccgtgcaactatcattttctgcattattgttatgtcatttt |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35412275 |
taaaatgctatgaatattacttaagttttatccatgataaacatacaacagctactgcaccgtgcaactatcattttctgcattattgttatgtcatttt |
35412374 |
T |
|
| Q |
118 |
gtgttctttaattggtagtacttgtatactggtctgcatttatgcagagtgcaatgaatactgaccagacttagtaggaggacggccagtaagacagcgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35412375 |
gtgttctttaattggtagtacttgtatactggtctgcatttatgcagagtgcaatgaatactgaccagacttagtaggaggacggccagtatgacagcgt |
35412474 |
T |
|
| Q |
218 |
gtgggatgaggattgtcttgaccacctagagttggccttgcataatcatttcctttgtctggatcacctaaatcattgtacacatcgtaatcataaatcc |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35412475 |
gtgggatgaggattgtcttgaccaccaagagttggccttgcataatcatttcctttgtctggatcacctaaatcattgtacacatcgtactcataaatcc |
35412574 |
T |
|
| Q |
318 |
tgtcacatgatgatttcatgcgtcctttcccactaccatcatcacctctc |
367 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35412575 |
tgtcccatgatgatttcatgcgtcctttcccactaccataatcacctctc |
35412624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 53430 - 53354
Alignment:
| Q |
34 |
ttacttaagttttatccatgataaacata-----caacagctactgcaccgtgcaactatcattttctgcattattg |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53430 |
ttacttaaattttatccatgataaacatatacaacaacaactactgcaccgtgcaactatctttttctgcattattg |
53354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 128 - 175
Target Start/End: Complemental strand, 53357 - 53310
Alignment:
| Q |
128 |
attggtagtacttgtatactggtctgcatttatgcagagtgcaatgaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
53357 |
attggtagtacttgtatactggtctgcatttatgtagtgtgcaatgaa |
53310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 318
Target Start/End: Original strand, 6371289 - 6371337
Alignment:
| Q |
270 |
ctttgtctggatcacctaaatcattgtacacatcgtaatcataaatcct |
318 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||| ||||| ||||| |
|
|
| T |
6371289 |
ctttgtctggttcacccaaatcattgtagacatcgtagtcatagatcct |
6371337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University