View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_116 (Length: 370)
Name: NF20384_low_116
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_116 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 17 - 349
Target Start/End: Complemental strand, 20755574 - 20755231
Alignment:
| Q |
17 |
aatattgctagaaggagaaatatgcaatggtattatgtcaattaatttattagcaattttattcttctcttagtatatcttttttgttggtggttcttct |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
20755574 |
aatattgctagaaggagaaatgtgcaatggtattatgtcaattaatttattagcaattttattcttctcttagtatattttttttgttggtgattcttct |
20755475 |
T |
|
| Q |
117 |
cttagtatttcttttcctagttatacatttgtgtatgtcattacttcttttatttttgacaaacttgtgtttgagtagttaggaacaaacttgtgtttga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
20755474 |
cttagtatttcttttcctagttatacatttgtgtatgtcattacttcttttatttttgacaaacttgtgtttgagtagttaggaacaaacttgtttttaa |
20755375 |
T |
|
| Q |
217 |
caa-cttcaattatagagatggtaacataagtgaagtg----------aaggatctttttctatgattcaattaaaaaatttcaaacaatttttcaagat |
305 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
20755374 |
caaccttcaattatagagatggtaacataagtgaagtgaatctaagataaggatctttttctatgattcaatttaatttttccaaacaatttttcaagat |
20755275 |
T |
|
| Q |
306 |
ctaaccctaaaaggagattcgaaaagccccttgataaaggttca |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20755274 |
ctaaccctaaaaggagattcgaaaagccccttgataaaggttca |
20755231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University