View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_127 (Length: 361)
Name: NF20384_low_127
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_127 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 44501550 - 44501899
Alignment:
| Q |
1 |
cgccaagtcagtctttacttacaatctcagtgagttttaatttcttctttgtcggtcgaattattatctcacttgacattctgataagaacctaatcatg |
100 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44501550 |
cgccaagtcggtctttacttacactctcagtgagttttaatttcttctttgtcggtcgaattattatctcacttgacattctgataagtacctaatcatg |
44501649 |
T |
|
| Q |
101 |
gaacaaaaacataacaaaattatatttttgcattaaaagttattgaataaatctacggcgagttattgtgactaagttacaaactaattgggttagtccg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44501650 |
gaacaaaaacataacagaattatatttttgcattaaaagttattgagcaaatctacggcgagttattgtgactaagttacaaactaattggattagtccg |
44501749 |
T |
|
| Q |
201 |
ataggaaacatgtcatggaggcttgtgtctttatttgcataatgtatgggcttttgtgatgggttattgaaccttttagtgaattaaccagtgaaccgta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44501750 |
ataggaaacatgtcatggaggcttgtgtctttatttgcataatgtatgggcttttgtgatgggttattgaaccttttagtgaattaaccagtgaaccgta |
44501849 |
T |
|
| Q |
301 |
tgtcttggccattcttatgtttatttttctccgacagcttttctgtgctc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44501850 |
tgtcttggccattcttatgtttatttttctccgacagcttttctgtgctc |
44501899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University