View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_172 (Length: 305)
Name: NF20384_low_172
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_172 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 286
Target Start/End: Complemental strand, 34649283 - 34649003
Alignment:
| Q |
11 |
aatatgaccttgtttggatgaagtgcttataacataagcagttatcatacacgtgcttatgtataactg---tcaaaaataatagagatccacctccttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
34649283 |
aatatgaccttgtttggatgaagtgcttataacataagcagttatcatacacgtgcttatgtacaactgctgtcaaaaataatagagatccacctccttc |
34649184 |
T |
|
| Q |
108 |
actcattgtcagatttcccgtaagcctgtttatttgagtcagtatacaacgatattgtaagacttcagggaagaatgagaagttccataagctattttgg |
207 |
Q |
| |
|
||||||| | ||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
34649183 |
actcattcttagattccctgtaagcatgtttatttgagtcagtatacaacgatattgtaagacttcagggaagaatgagaagttccaaaagcaattttgg |
34649084 |
T |
|
| Q |
208 |
ttcaacttgacaaacaaactagcaaagacagtgagcaaattagcaaacaa--acagtaaaagaactcaacaaagcaaacac |
286 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
34649083 |
ttcaatttggcaaacaaactagcaaagacagtgagcaaattagcaaacaaacacagtaaaagaactcaacaaaggaaacac |
34649003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 19977627 - 19977704
Alignment:
| Q |
1 |
aatttgatacaatatgaccttgtttggatg--aagtgcttataacataagcagttatcatacacgtgcttatgtataa |
76 |
Q |
| |
|
||||| ||||||||||||| | ||||||| |||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
19977627 |
aattttatacaatatgaccctctttggatataaagtgcttttaacataaacagttatcatacacatgcttatgtataa |
19977704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University