View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_184 (Length: 287)
Name: NF20384_low_184
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_184 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 60 - 271
Target Start/End: Original strand, 11711262 - 11711473
Alignment:
| Q |
60 |
ttacttgtgagtaagtgatagtccttatctcttttcatctcatgttaatttaaattaattaggaattgtgtgctcttcaccctttatctgccaaaccact |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11711262 |
ttacttgtgagtaagtgatagtccttatctcttttcatctcatgttaatttaaattaattaggaattgtgtgctcttcaccctttatctgccaaaccact |
11711361 |
T |
 |
| Q |
160 |
gaaagattgaaacattaaagtagaatatatttgcatgaatattggttatttgtttatttagttattggtagtgtaaatgtgatcaatcttttttaaatct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11711362 |
gaaagattgaaacattaaagtagaatatatttgcatgaatattggttatttgtttatttagttattggtagtgtaaatgtgatcaatcttttttaaatct |
11711461 |
T |
 |
| Q |
260 |
gaattttaggag |
271 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11711462 |
gaattttaggag |
11711473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 45
Target Start/End: Original strand, 11711215 - 11711249
Alignment:
| Q |
11 |
ttatactattaatttaagatcatgtgcaagtgcgt |
45 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11711215 |
ttatattattaatttaagatcatgtgcaagtgcgt |
11711249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University