View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_185 (Length: 286)
Name: NF20384_low_185
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_185 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 49 - 125
Target Start/End: Original strand, 5017803 - 5017879
Alignment:
| Q |
49 |
taaattgaagaaagacatgaaactgtctctaaaggcagaaaattacaactctcaaattagagattgtcttaaatttg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5017803 |
taaattgaagaaagacatgaaactgtctctaaaggcagaaaattacaactttcaaattagagattgtcttaaatttg |
5017879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 271
Target Start/End: Original strand, 5017983 - 5018040
Alignment:
| Q |
214 |
gtgctttaaaaaagatgtaatatttgagacaatgcttacagctccttgggatccatct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017983 |
gtgctttaaaaaagatgtaatatttgagacaatgcttacagctccttgggatccatct |
5018040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 5017725 - 5017774
Alignment:
| Q |
1 |
taaaactcatttttagtattattttcttcagcctagttaaatcaacttta |
50 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
5017725 |
taaaactcatttttagtattatttttttcaacctagttaaatcaacttta |
5017774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 5017889 - 5017922
Alignment:
| Q |
119 |
aaatttggttgtccaatcatacttttgtttatga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5017889 |
aaatttggttgtccaatcatacttttgtttatga |
5017922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University