View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_186 (Length: 285)
Name: NF20384_low_186
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_186 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 12 - 265
Target Start/End: Complemental strand, 52584904 - 52584651
Alignment:
| Q |
12 |
agaatatatactatactagcttttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactcctttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584904 |
agaatatatactatactagcttttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactcctttt |
52584805 |
T |
|
| Q |
112 |
ctctttttccataaaaatctctcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttccaattgagttgttcccttaagg |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584804 |
ctccttttccataaaaatctctcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttccaattgagttgttcccttaagg |
52584705 |
T |
|
| Q |
212 |
gacacaatacaatacaagtatagaactagtttattttttcaatcactttctctc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52584704 |
gacacaatacaatacaagtatagaactagtttatttattcaatcactttctctc |
52584651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University