View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_194 (Length: 280)
Name: NF20384_low_194
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_194 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 50235411 - 50235660
Alignment:
| Q |
19 |
atataatgtatttctagagagaaaatgaaacaatattgattggaagggataaattaattaatttgttacaatatataatgtaacaccttgatttgtgctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235411 |
atataatgtatttctagagagaaaatgaaacaatattgattggaagggataaattaattaatttgttacaatatataatgtaacaccttgatttgtgctt |
50235510 |
T |
 |
| Q |
119 |
atgggattcgtttgttcagattgaatatatctctcacnnnnnnnnaatgattgatgtggattctttacatacgttttatggtgcataactttatgtgttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235511 |
atgggattcgtttgttcagattgaatatatctctcacttttttttaatgattgatgtggattctttacatacgttttatggtgcataactttatgtgttt |
50235610 |
T |
 |
| Q |
219 |
tgagtaaagaattcactattcaaaacggtgctagcctgcaatgtaggttc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235611 |
tgagtaaagaattcactattcaaaacggtgctagcctgcaatgtaggttc |
50235660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University