View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_199 (Length: 278)
Name: NF20384_low_199
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_199 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 39291702 - 39291940
Alignment:
| Q |
1 |
agtgagatgtattttcttttttgaaaggagtgagatatttannnnnnnggttactcaatagtgagacacgcaagtcaatatttgtgtcaataaaaagtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39291702 |
agtgagatgtattttcttttttgaaaggagtgagatatttatttttttg----------agtgagacacataagtcaatatttgtgtcaataaaaagtta |
39291791 |
T |
 |
| Q |
101 |
acttaaattaactaatatttaattaacacgtgagatgatttttaattagctggttttttgctaatgttttatattacaatccaaaatcgcagtctccctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39291792 |
acttaaattaactaatatttaattaacacgtcagttgatttttaattaactggttttttgctaatgttttatattacaatccaaaattgcagtctccctt |
39291891 |
T |
 |
| Q |
201 |
cccaaataaataaatatatattgcaactactgtagagtgcaatctaaaa |
249 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
39291892 |
cccaaataaataaataaatattgcaactactgtacagtgcaatctaaaa |
39291940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University