View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_217 (Length: 253)
Name: NF20384_low_217
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_217 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 4031903 - 4031736
Alignment:
| Q |
7 |
ggagcagaggagtataaggagtttgtagctgaggtgcaaaccattgggaaggttaagcatcctaatattgtgaggttgagagcttattattgggcacatg |
106 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031903 |
ggagaagagaagtataaggagtttgtagctgaggtgcaaaccattgggaaggttaagcatcctaatattgtgaggttgagagcttattattgggcacatg |
4031804 |
T |
 |
| Q |
107 |
atgaaaagcttcttataagtgattttatttccaatggcaatttgaacaatgcacttcgaggtcagttc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031803 |
atgaaaagcttcttataagtgattttatttccaatggcaatttgaacaatgcacttcgaggtcagttc |
4031736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 49 - 150
Target Start/End: Original strand, 25882809 - 25882910
Alignment:
| Q |
49 |
attgggaaggttaagcatcctaatattgtgaggttgagagcttattattgggcacatgatgaaaagcttcttataagtgattttatttccaatggcaatt |
148 |
Q |
| |
|
|||||||| || || |||||||||||||| | ||| ||||||||||||||||| ||||||||||||||| | || ||||||||| |||| |||||||||| |
|
|
| T |
25882809 |
attgggaaagtgaaacatcctaatattgttaagttaagagcttattattgggctcatgatgaaaagcttttgattagtgattttgtttctaatggcaatt |
25882908 |
T |
 |
| Q |
149 |
tg |
150 |
Q |
| |
|
|| |
|
|
| T |
25882909 |
tg |
25882910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University