View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_223 (Length: 251)
Name: NF20384_low_223
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_223 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 52763979 - 52763733
Alignment:
| Q |
1 |
aagttggtttgctgatattgccacaaccactagaatcacataaaattttctgttgattgtccaaattgaacaaagtgatcagaaacactaaatagattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
52763979 |
aagttggtttgctgatattgccacaaccactagaatcacataaaattttatgttgattgtccaaattgaacaaagtggtctgaaacacaaaataga---- |
52763884 |
T |
 |
| Q |
101 |
gtgatgata-taccaagccaatgaaaatatgatttgccaatattgccacaaccactaacacaaagttttgaattctggtaaatgatgcctcgtatgaaaa |
199 |
Q |
| |
|
|| | | || ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763883 |
gtcaaaacggtaacaa-ctaatgaaaatatgatttgccaatattgccacaaccactaacacaaagttttgaattctggtaaatgatgcctcgtatgaaaa |
52763785 |
T |
 |
| Q |
200 |
gattatccttggttaggaatccgattgtgaagaatacacgaaataaaaacac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763784 |
gattatccttggttaggaatccgattgtgaagaatacacgaaataaaaacac |
52763733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University