View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_227 (Length: 250)
Name: NF20384_low_227
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_227 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 52004779 - 52004565
Alignment:
| Q |
1 |
catgcatctaacaatttgtctaacatgcaactttctactttgcttcacatacaaatgcaacttgtattcgcatgcattatgtccacgtgtcaatgatgg- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52004779 |
catgcatctaacaatttgtctaacatgcaactttctactttgcttcacatataaatgcaacttgtattcgcatgcatt------------caatgatggg |
52004692 |
T |
|
| Q |
100 |
accccacaaattggtcatttagattaaacgaaatttaaagaagacat----agtgaaatttaatttctgatatttaagaatgagagagaaattaaatgac |
195 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52004691 |
atcccacaaattggtcatttagattaaacgaaatttaaagaagacatggatagtgaaacttaatttctgatatttaagaatgagagagaaattaaatgac |
52004592 |
T |
|
| Q |
196 |
cattcaattgtacaattttacttgaatg |
223 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
52004591 |
cattcaa-tgtacaattttacttgaatg |
52004565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University