View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_228 (Length: 250)
Name: NF20384_low_228
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_228 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41752965 - 41752728
Alignment:
| Q |
1 |
caagtataacaaatgtgacacatgcatgtttatttttt-atcttctactaccaaactacttttcaaaattacaccaaaaaatcaaattacacataattgg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752965 |
caagtataacaaatgtgacacatgcatgtttatttttttatcttctactaccaaactacttttcaaaattacaccaaaaaatcaaattacacataattgg |
41752866 |
T |
 |
| Q |
100 |
ttaatatgccacatagtgataaaactattactaaaatataacaacaccgatttaaactttgccaaatatagtgtcattgtgtttattgtgttagtgggtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752865 |
ttaatatgccacatagtgataaaactattactaaaatataacaacaccgatttaaactttgccaaatatagtgtcattgtgtttattgtgttagtgggtg |
41752766 |
T |
 |
| Q |
200 |
gatcataaagtactcacgtcccttcaattcaaccagaa |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41752765 |
gatcataaagtactcacatcccttcaattcaaccagaa |
41752728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University