View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_229 (Length: 250)
Name: NF20384_low_229
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_229 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 13 - 129
Target Start/End: Original strand, 33664711 - 33664827
Alignment:
| Q |
13 |
aatatggatgcatacatatattatgagaaagagagattagctataagaaatatatgaagaaaaaatgtatgttatattaatatcgtgatgttaatacatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33664711 |
aatatggatgcatacatatattatgagaaagagagattagttataagaaatatatgaagaagaaatgtatgttatattaatatcgtgatgttaatccatt |
33664810 |
T |
|
| Q |
113 |
actttgtgtctaggatg |
129 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33664811 |
actttgtgtctaggatg |
33664827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 98
Target Start/End: Original strand, 33686513 - 33686598
Alignment:
| Q |
13 |
aatatggatgcatacatatattatgagaaagagagattagctataagaaatatatgaagaaaaaatgtatgttatattaatatcgt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33686513 |
aatatggatgcatacatatattatgagaaagagagattagttataagaaatatatgaagaagaaatgtatgttatattaatatcgt |
33686598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 169 - 250
Target Start/End: Original strand, 33664828 - 33664908
Alignment:
| Q |
169 |
aaaacttgagcaatttgaaccgcaccttttatttctctttagggtgtgcctggtttttggttgtattactaagcttttgttc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33664828 |
aaaacttgagcaatttgaaccgcaccttttatt-ctctttagggtttgcctggtttttggttgtattactgagcttttgttc |
33664908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University