View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_238 (Length: 244)
Name: NF20384_low_238
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_238 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 28464197 - 28463962
Alignment:
| Q |
1 |
ttgagacaatttgttttacttataatttgggacggaaagagtacttgttataatatgtaataaatttcttaattaaacattaactgatgctctctccaca |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
28464197 |
ttgagacaattttttttacttataatttgggacggaaagagtagtttctataatatgtaataaatttcttaattaaacattaaccgattctctctccaca |
28464098 |
T |
 |
| Q |
101 |
cctcactgtgaccttactgatgtcttgatgcaaggccgtgcatacacttggtatagacgattgagttcgtatcacgtggttgaagaaagac--tataggg |
198 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
28464097 |
ccacactgtgaccttactgatgtcttgatgcaaggccatgcatacacttggtctagacgattgggttcgtatcatgtggttgaagaaagactttataggg |
28463998 |
T |
 |
| Q |
199 |
ttttagttactcattttttgatgaggatgtttccat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28463997 |
ttttagttactcattttttgatgaggatgtttccat |
28463962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University