View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_240 (Length: 243)
Name: NF20384_low_240
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_240 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 47652397 - 47652187
Alignment:
| Q |
18 |
tatatttactttaattagtgatgatatcattttatatgtattatcattggagtaccttttatacttttttgaattaatatattatctttgattatcaata |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47652397 |
tatatttactttaattagtgattatatcattttatatgtattatcattggagtaccttttatacttttttgaattaatatattatctttgattatcaata |
47652298 |
T |
|
| Q |
118 |
a--caatcacaagacttattattattacaatcagtccgatttcttgatcacaaattgtcaatgtgacagcaaactatattagtgtctgagtcttcttatt |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47652297 |
aaacaatcacaagacttattattattacaatcagtccgatttcttgatcacaaattgtcaatgtgacagctaactatattagtgtctgagtcttcttatt |
47652198 |
T |
|
| Q |
216 |
ttctaagatat |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
47652197 |
ttctaagatat |
47652187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University