View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_247 (Length: 238)
Name: NF20384_low_247
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_247 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 8874354 - 8874575
Alignment:
| Q |
1 |
cagaataagaccccatatgagtaataccccnnnnnnntatactcttttgttttatgatattattgatatactctcttatatagaatataacaataaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8874354 |
cagaataagaccccatatgagtaataccccaaaaaaatatactcttttgttttatgatattattgatatactctcttatatagaatataacaataaatgc |
8874453 |
T |
 |
| Q |
101 |
tttgttagtaaccaacaaacaactcttaagtctcacaacaaaggaaagagaaatttt--nnnnnnnnnnnnaaaagagagagaatagggttgatctaaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8874454 |
tttgttagtaaccaacaaacaactcttaagtctcacaacaaaggaaagagaaatttttgtgtgtgtgtgtgaaaagagagagaataggattgatctaaaa |
8874553 |
T |
 |
| Q |
199 |
tcagtagagggattgtggtaag |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8874554 |
tcagtagagggattgtggtaag |
8874575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University