View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20384_low_254 (Length: 235)

Name: NF20384_low_254
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20384_low_254
NF20384_low_254
[»] chr4 (1 HSPs)
chr4 (11-230)||(51651324-51651543)
[»] chr2 (1 HSPs)
chr2 (128-230)||(19154348-19154450)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 51651324 - 51651543
Alignment:
11 tcatcatattgtactctcttggtttcaaaaataagcaaaaaattctatgaatttagcttacttgtatattgtttatggataattctctaattggttggta 110  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
51651324 tcataatattgtactctctcggtttcaaaaataagcaaaaaattctatgaatgtagcttacttgtatattgtgtatggataattctctaattggttggta 51651423  T
111 cttgtggatgtatgttcttgttaaatacagatcacccgtcttctccccgatgcagtcggaactacttgtggccaacgacttgagaaggtctacggaactg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
51651424 cttgtggatgtatgttcttgttaaatacagatcacccgtcttctccccgatgcagtcggaacgacttgtggccaacgacttgagaaggtctacggaactg 51651523  T
211 agcattgccatattcttcga 230  Q
    |||||||||| |||||||||    
51651524 agcattgccacattcttcga 51651543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 230
Target Start/End: Complemental strand, 19154450 - 19154348
Alignment:
128 ttgttaaatacagatcacccgtcttctccccgatgcagtcggaactacttgtggccaacgacttgagaaggtctacggaactgagcattgccatattctt 227  Q
    ||||||||| |||||||||||||||||||| |||||||| ||||||||||||||  |||| |||||||| || ||||  || || |||||||| ||||||    
19154450 ttgttaaatgcagatcacccgtcttctccctgatgcagtgggaactacttgtggtgaacgtcttgagaaagtatacgataccgaacattgccacattctt 19154351  T
228 cga 230  Q
    |||    
19154350 cga 19154348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University