View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_256 (Length: 234)
Name: NF20384_low_256
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_256 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 52380006 - 52379804
Alignment:
| Q |
16 |
aatatcgtgtaaaaagtaatagccaacttgcaaacacccccacttgacactcccttatttaaggaactagtaccacaatttctccttaacccccaaagtc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380006 |
aatatcgtgtaaaaagtaatagccaacttgcaaacacccccacttgacaatcccttatttaaggaactagtaccacaatttctccttaacccccaaagtc |
52379907 |
T |
 |
| Q |
116 |
tctacattaagacattgagctagttcaagtcaccatcttttctcataataaacaaacaacaactctcttactattttgtgttttctacttcaaacacaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52379906 |
tctacattaagacattgagctagttcaagtcaccatattttctcataataaacaaacaacaactctcttactgttttgtgttttctacttcaaacacaat |
52379807 |
T |
 |
| Q |
216 |
tgt |
218 |
Q |
| |
|
||| |
|
|
| T |
52379806 |
tgt |
52379804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University