View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_257 (Length: 234)
Name: NF20384_low_257
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_257 |
 |  |
|
| [»] scaffold1113 (1 HSPs) |
 |  |  |
|
| [»] scaffold0961 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1113 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 1442 - 1387
Alignment:
| Q |
159 |
tttgtgaggaaggggctaaagcatgttaaatgccctaactaaaattaggcagttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1442 |
tttgtgaggaaggggctaaagcatgttaaatgccctaactaaaattaggcagttgt |
1387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 159 - 214
Target Start/End: Original strand, 2175 - 2230
Alignment:
| Q |
159 |
tttgtgaggaaggggctaaagcatgttaaatgccctaactaaaattaggcagttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2175 |
tttgtgaggaaggggctaaagcatgttaaatgccctaactaaaattaggcagttgt |
2230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University