View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_low_278 (Length: 209)
Name: NF20384_low_278
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_low_278 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 20 - 194
Target Start/End: Original strand, 4694014 - 4694188
Alignment:
| Q |
20 |
gataaactcttctatttttctatccgataaaagtaattgctgcgtgtaagtgtgagttatttgtccacattaaatagaaaaatgaatttgaacactttac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
4694014 |
gataaactcttctatttttctatccgatcaaagtaattgctgcgtgcaagtgtaagttatttgtccacatcaaatagaaaaatgaatttaaacactttac |
4694113 |
T |
 |
| Q |
120 |
aagtaagatgaccaataaacctaaaaccttatgatattgggtaaaagtcgtgtgatgtgtatatgattgttctga |
194 |
Q |
| |
|
|||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4694114 |
aagtgagatgaccaataaacctaaaactttataatattgggtaaaagtcgtgtgatgtctatatgattgttctga |
4694188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University