View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20387_low_5 (Length: 428)
Name: NF20387_low_5
Description: NF20387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20387_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 281 - 417
Target Start/End: Complemental strand, 12545612 - 12545476
Alignment:
| Q |
281 |
caatgtgtagagaatcaccctactattgaagccaaagactaacatacataggtttactgctagattgctttctaacataccatgtattttaattagtcaa |
380 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12545612 |
caatgtgtagagagtcatcctactattgaagccgaagactaacatacataggtttactgctagattgctttctaacataccatgtattttaattagtcaa |
12545513 |
T |
 |
| Q |
381 |
ggaaatatttcctttgacaaagggtatacctttattt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12545512 |
ggaaatatttcctttgacaaagggtatacctttattt |
12545476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 227 - 275
Target Start/End: Complemental strand, 12546456 - 12546408
Alignment:
| Q |
227 |
cattaattctgttgtagctgcttgaattgtggaaacatattggtcttgt |
275 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12546456 |
cattgattctgttgtagctgcttgaattgtggaaacatattggtcttgt |
12546408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 12537637 - 12537681
Alignment:
| Q |
175 |
tagatatcaagggctgaacaa-ttttatctaatgtgcattcattt |
218 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
12537637 |
tagatatcaagggctgatcaatttttatccaatgtgcattcattt |
12537681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University