View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20388_high_13 (Length: 241)
Name: NF20388_high_13
Description: NF20388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20388_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 49266531 - 49266322
Alignment:
| Q |
14 |
ataatactttatcatttgtgcagagagatcaaaattgctgagttcctcgagtcctaaggcagaattggagagtgtctcgggtcctaagacgcgtgatgag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49266531 |
ataatactttatcatttgtgcagagagatcaaaattgctgagttcctcgagtcctaaggcagaattggagagtgtctcgggtcctaagacgcgtgatgag |
49266432 |
T |
 |
| Q |
114 |
gcagaagccaatccgcgtgcacgtacattcacattacaagagcttaaagccgcaaccaacaactttgcgccggaatgttttataggtgaagggggctttg |
213 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49266431 |
gcagaagccaatccgcgtgcacatacattcacattacaagagcttaaagccgcaaccaataactttgcgccggaatgttttataggtgaagggggctttg |
49266332 |
T |
 |
| Q |
214 |
ggcctgtata |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
49266331 |
ggcctgtata |
49266322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University