View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20388_low_10 (Length: 250)
Name: NF20388_low_10
Description: NF20388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20388_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 25019586 - 25019363
Alignment:
| Q |
13 |
aaaatcgcgtgaattagggcagcaaaaatttgtttacgacagttttagccaccactatataccaaaatggaatttttaaaactgtcgtaatttcgcatgc |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
25019586 |
aaaatcgcgtgaattagggcggcaaaaatttgtttacgacagttttagccaccgctatataccaaaatgggattttcaaaactgtcgtaatttcgcatgc |
25019487 |
T |
 |
| Q |
113 |
cacaaagtttaaaacagtggtttaagaagaaccaccatgtaaattggcatagtacacgttgaataaaaaggcagctaata-tttggataaaacggcagtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25019486 |
cacaaagtttaaaacagtggtttaagaagaaccaccatgtaaattggcatagtacacgttgaataaaaaggcagctaatattttgaataaaacggcagtt |
25019387 |
T |
 |
| Q |
212 |
ttaaccaccataatatacactttt |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25019386 |
ttaaccaccataatatacactttt |
25019363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 54 - 151
Target Start/End: Original strand, 3600217 - 3600314
Alignment:
| Q |
54 |
gttttagccaccactatataccaaaatggaatttttaaaactgtcgtaatttcgcatgccacaaagtttaaaacagtggtttaagaagaaccaccatg |
151 |
Q |
| |
|
|||||| || |||||||| |||||||||| ||||| |||| || |||||||| | || ||||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
3600217 |
gttttaaccgccactataaaccaaaatggcattttcaaaattgccgtaattttgtctgtcacaaagtttaaaacggtgatttaagaagaatcaccatg |
3600314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University