View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20388_low_14 (Length: 234)
Name: NF20388_low_14
Description: NF20388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20388_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 33159863 - 33160065
Alignment:
| Q |
15 |
agagaaacaatcctagaaactggtctgtctagcttttgcttgagcttcaatttgatgtaacttttgagatcataatcaatttgatctcctttacttggag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33159863 |
agagaaacaatcctagaaactggtctgtctagcttttgcttgagcttcaatttgatgtaacttttgagatcataatcaatttgatctcctttacttggag |
33159962 |
T |
 |
| Q |
115 |
ttacttgttggaactgaggtgcgaatagaagaacagttccaaggaggaatcctgatataaaacctccaatgcttgaaaaattgtctacataaggcagaaa |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33159963 |
ttacctgttggaactgaggtgcgaatagaagaacagttccaaggaggaatcctgatataaaacctccaatgcttgaaaaattgtctacataaggcagaaa |
33160062 |
T |
 |
| Q |
215 |
acc |
217 |
Q |
| |
|
||| |
|
|
| T |
33160063 |
acc |
33160065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University