View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20388_low_9 (Length: 253)
Name: NF20388_low_9
Description: NF20388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20388_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 1715720 - 1715935
Alignment:
| Q |
17 |
acatgcgtgaaatgtgaattcatttgtcgagtgaattcacatacgtaattgacattcgta-cta-----gtaatcga--ccagagcttggccacatacat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||| | ||| |||| | | |||||||||||||||| || |
|
|
| T |
1715720 |
acatgcgtgaaatgtgaattcatttgtcgagtgaattcacatacgtaatt-atgttcttgtctaatcacgtaaagaaaactagagcttggccacatatat |
1715818 |
T |
 |
| Q |
109 |
tcgtactagtaataatatttaaaaattaaggaaaattgatggagaaaaattaacaggccaattgtatggttctaataatgtgatgccnnnnnnnttaggc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1715819 |
tcgtactagtaataatatttaaaaattaaggaaaattgatggagaaaaattaacaggccaattatatggttctaataatgtgatgccaaaaaaattaggc |
1715918 |
T |
 |
| Q |
209 |
aactacacaattcgtcc |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1715919 |
aactacacaattcgtcc |
1715935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University