View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20389_high_6 (Length: 269)
Name: NF20389_high_6
Description: NF20389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20389_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 254
Target Start/End: Complemental strand, 52584456 - 52584222
Alignment:
| Q |
20 |
atttgatggatctacttggtgcagcaaacgagaataatcaccagacacaacaaggcctatccctttctttaggctctcacatgcttgttgatgaatacag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584456 |
atttgatggatctacttggtgcagcaaacgagaataatcaccagacacaacaaggcctatccctttctttaggctctcacatgcttgttgatgaatacag |
52584357 |
T |
 |
| Q |
120 |
aaaccgttccttaaatcaaggtcttatgatcaatccaagttacttcatgcctggtcaagatcagacacgtgagccttgtaatcaacctgtggtggagaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584356 |
aaaccgttccttaaatcaaggtcttatgatcaatccaagttacttcatgcctggtcaagatcagacacgtgagccttgtaatcaacctgtggtggagaat |
52584257 |
T |
 |
| Q |
220 |
ctaacaagtgattattttttcagtggtggaagtgg |
254 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52584256 |
ctaactagtgattattttttcagtggtggaagtgg |
52584222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University