View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20389_high_7 (Length: 243)
Name: NF20389_high_7
Description: NF20389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20389_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 445696 - 445471
Alignment:
| Q |
16 |
taaacctctcatctttgcaatgtacttgcccctcctcacgctaatgtgttttataagctgtcaaatttttgccacacaatcgttagaagttggatttgga |
115 |
Q |
| |
|
||||||||||||| |||| ||||| | || || |||| ||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
445696 |
taaacctctcatccttgctatgtattatgccatcatcaccctaatgtgtttaataagctgtcaaatttttgccacacaggcgtgggaagttggatttgga |
445597 |
T |
|
| Q |
116 |
gcaacactctgcataagggatctatccgatcaatatcagacgattcaaattttaaagcaatannnnnnnnnnnnnnnngctgctgaatataaaattctaa |
215 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
445596 |
gcaacactctgcacaagggatatatccgatcaatatcagacgattcaaattttaaagtaatatttttatttttattttgctgctgaatataaaattctaa |
445497 |
T |
|
| Q |
216 |
agttgaaatttagatcattcaatatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
445496 |
agttgaaatttagatcattcaatatt |
445471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University