View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20389_low_4 (Length: 335)
Name: NF20389_low_4
Description: NF20389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20389_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 249
Target Start/End: Original strand, 38447085 - 38447319
Alignment:
| Q |
15 |
cagagatacgtggataacaatgttgatcgcagaagagttactccggttcattcctcgaggagtgaaccgaaccggcaatcaccgaaccagtcgccgagaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38447085 |
cagagatacgtggataacaatgttgatcgcagaagagttactccggttcattcttcgaggagtgaaccgaaccggcaatcaccgaaccagtcgccgagaa |
38447184 |
T |
|
| Q |
115 |
tgagaaaagttgccacttaccaaaaagagaaggcctcggtggaagatgaatcatcaagtacctcttcacataccgatactgaggtttgtatattttatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38447185 |
tgagaaaagttgccacttaccaaaaagagaagtcctcggtggaagatgaatcatcaagtacctcttcacataccgatactgaggtttgtatattttatta |
38447284 |
T |
|
| Q |
215 |
atttttcatatcttaaatcgattagatcacgatag |
249 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38447285 |
atttttcatatcttatatcgattagatcacgatag |
38447319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University