View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20389_low_8 (Length: 226)
Name: NF20389_low_8
Description: NF20389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20389_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 26456444 - 26456652
Alignment:
| Q |
1 |
atactggttaaaaatttgaaaaacgagttaattgaacgcaatcacatgcgtcattgtctcaaatttgattttagtctcaatagtcacttttttcggggag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26456444 |
atactggttaaaaatttgaaaaatgagttaattgaacgcaatcacatgtatcattgtctcaaatttgattttagtctcaatagtcacttttttcggggag |
26456543 |
T |
|
| Q |
101 |
gtaaattacaagaatgcatgcatctagtcctgtcaagggattaaaaatatgtagttttgtaatctgtagggattaataaagggatagatggtgtttagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26456544 |
ataaattacaagaatgcatgcatctagtcatgtgaagggattaaaaatatgtagttttgtaatctgtagggattaataaagggatagacggtgtttagca |
26456643 |
T |
|
| Q |
201 |
gacgagact |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
26456644 |
gacgagact |
26456652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 4991196 - 4991147
Alignment:
| Q |
9 |
taaaaatttgaaaaacgagttaattgaacgcaatcacatgcgtcattgtc |
58 |
Q |
| |
|
||||||||||||||| || ||||||||| | ||||||||| ||||||||| |
|
|
| T |
4991196 |
taaaaatttgaaaaatgaattaattgaatgtaatcacatgtgtcattgtc |
4991147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University