View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20389_low_8 (Length: 226)

Name: NF20389_low_8
Description: NF20389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20389_low_8
NF20389_low_8
[»] chr8 (1 HSPs)
chr8 (1-209)||(26456444-26456652)
[»] chr5 (1 HSPs)
chr5 (9-58)||(4991147-4991196)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 26456444 - 26456652
Alignment:
1 atactggttaaaaatttgaaaaacgagttaattgaacgcaatcacatgcgtcattgtctcaaatttgattttagtctcaatagtcacttttttcggggag 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||    
26456444 atactggttaaaaatttgaaaaatgagttaattgaacgcaatcacatgtatcattgtctcaaatttgattttagtctcaatagtcacttttttcggggag 26456543  T
101 gtaaattacaagaatgcatgcatctagtcctgtcaagggattaaaaatatgtagttttgtaatctgtagggattaataaagggatagatggtgtttagca 200  Q
     |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
26456544 ataaattacaagaatgcatgcatctagtcatgtgaagggattaaaaatatgtagttttgtaatctgtagggattaataaagggatagacggtgtttagca 26456643  T
201 gacgagact 209  Q
    |||||||||    
26456644 gacgagact 26456652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 4991196 - 4991147
Alignment:
9 taaaaatttgaaaaacgagttaattgaacgcaatcacatgcgtcattgtc 58  Q
    ||||||||||||||| || ||||||||| | ||||||||| |||||||||    
4991196 taaaaatttgaaaaatgaattaattgaatgtaatcacatgtgtcattgtc 4991147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University