View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2038_high_16 (Length: 364)
Name: NF2038_high_16
Description: NF2038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2038_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 348
Target Start/End: Complemental strand, 26018869 - 26018535
Alignment:
| Q |
13 |
aatatgcccacaatcataaccttgttgtatgcctccatctctgctcaaatttatatatatagggtgaatgaaaatcagaactacactgtcatatccatga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26018869 |
aatatgcccacaatcataaccttgttgtatgcctccatctctgctcaaatttatatatatagggtgaatgaaaatcagaactacactgtcatatccatga |
26018770 |
T |
|
| Q |
113 |
gaatgagaacnnnnnnnnnnnngtgagaaaatgttgaattgcaatttgcaggatattattactatattgtacataatgttcccgtgatcatggcttcgct |
212 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
26018769 |
gaatgagaactatatatatatagtgtgaaaatgttgaattgcaatttgcaggatattattactatattgtacataatgttcccgtgaccatggcctcgct |
26018670 |
T |
|
| Q |
213 |
ggccaattggcaatactatgtgccattgtatcacgggtgagcatttggtgctttcaaggaattgggttaattagtactaacattg--ggttttagttgtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
26018669 |
ggccaattggcaatactatgtgccattgtatcacgggtgatcatttggtactttcaaggaattgggt---ttagtagtaacattggaggttttagttgtt |
26018573 |
T |
|
| Q |
311 |
caaattttatatatatgtatatagtaaaaggataataa |
348 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
26018572 |
caaattatatatatatgaatatagtaaaaggataataa |
26018535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 26003009 - 26002968
Alignment:
| Q |
13 |
aatatgcccacaatcataaccttgttgtatgcctccatctct |
54 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26003009 |
aatatccccacaatcataatcttcttgtatgcctccatctct |
26002968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University