View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2038_high_18 (Length: 356)
Name: NF2038_high_18
Description: NF2038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2038_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 35421166 - 35421350
Alignment:
| Q |
14 |
cattttgcactaatgaatgattgttcttatgaggaagaggatttgtataggtattatgttgttggaggaatttttagaggcttagatggaaaggatgaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35421166 |
cattttgcactaatgaatgattgttcttatgaggaagaggaat-gtataggtattatgttgttggaggaatttttagaggcttagatggaaaggatgaga |
35421264 |
T |
|
| Q |
114 |
aaaggagggaaataaggaggtgtggtagaaagggagctttcaagtaggttggaaggggaagttgataatgaacatcaatgctgtgt |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35421265 |
aaaagagggaaataaggaggtgtggtagaaagggagctttcaagtaggttggaaggggaagttgataatgaacatcaatgctgtgt |
35421350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 212 - 350
Target Start/End: Original strand, 35421376 - 35421512
Alignment:
| Q |
212 |
ggggtttaggaccaattttaaattgggaaggaagggaccatttgtttgtttagggaaagagataaaggtaaaaggggacaatgaacattgaaagtttcta |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35421376 |
ggggtttaggaccaattttaaattgggaaggaagggaccatttgtttgtttagggaaagagataaaggtaaaaggggacaatgaacattgaaagtttcta |
35421475 |
T |
|
| Q |
312 |
gtatatattttttatttgaggtaaagactttcatatcag |
350 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35421476 |
g--tatattttttatttgaggtaaagactttcatatcag |
35421512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University