View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2038_low_26 (Length: 323)
Name: NF2038_low_26
Description: NF2038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2038_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 304
Target Start/End: Complemental strand, 43815351 - 43815064
Alignment:
| Q |
11 |
acatcatcagtcaatacattcggcgtattcgtaacccaaattcctttctctctgcaattcttcagatcaattttatcaaatccaacgctgtaagtagaca |
110 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
43815351 |
acatcatcagtcaacacatccggcgtattcgtaacacaaatccctttctccctgcatttcttcagatcaattttatcaaatccaacactgtaagtagaaa |
43815252 |
T |
 |
| Q |
111 |
caatctcaagattaggaagagaatcgattgtgtttgcgtcggctccgattttggtgctgcaaaccaatgcgcgaatggaatttgcgtgggtttcagacaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||||||||||| ||||||||||||| ||||| ||||||||||||||||| || || |
|
|
| T |
43815251 |
caatctcaagattaggaagagaatcgattgtatttgcatccgctccgattttggtgttgcaaaccaatgcacgaattgaatttgcgtgggtttctgagaa |
43815152 |
T |
 |
| Q |
211 |
ggattggaaggaaggatagttccagagtttgaagaggttgaaacggttggaattggaaagttgttcttcgaggtttgtgttcattggatatgtc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43815151 |
ggattggaaggaaggatagttccagagtttgaagaggttgaaacggt------tggagagttgttcttcgaggtttgtgttcattgggtatgtc |
43815064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University