View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2038_low_30 (Length: 236)
Name: NF2038_low_30
Description: NF2038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2038_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43862009 - 43861789
Alignment:
| Q |
1 |
caaatatcgttgttgcatattgacttaacgtcgttaaattgttgacatcaacaccttactaagggatgttgcaagctcttctgtcgatagaaactgacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43862009 |
caaatatcgttgttgcatattgacttaacgtcgttaaattgttgacatcaacaccttattaagggatgttgcaagctcttctgtcgatagaaactgacac |
43861910 |
T |
 |
| Q |
101 |
aaagaaaacggaatggtttgagatagaagaggcatgcatttaacgtgtacgataaatggtcaattccatccgcagaaactaccatcatatggaatagtcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43861909 |
aaagaaaacggaatggtttgagatagaagaggcatgcatttaacgtgtacgataaatggtcaattccatccgcagaaactaccatcatatggaataatcg |
43861810 |
T |
 |
| Q |
201 |
atgttgtcaaaccttgattat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43861809 |
atgttgtcaaaccttgattat |
43861789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University