View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2038_low_33 (Length: 228)
Name: NF2038_low_33
Description: NF2038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2038_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 39682229 - 39682023
Alignment:
| Q |
1 |
ttgcgtttattgtgatacttgccgtgctggattcgaaaccaacgccacattttacatccaaggtacatacatacacatcactttgtatacaccttagcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39682229 |
ttgcgtttattgtgatacttgccgtgctggattcgaaaccaacgccacattttacatccaaggtacatatatacacatcactttctatacaccttagcgt |
39682130 |
T |
|
| Q |
101 |
aaaaagtttttagactgtctatgattgaagtcaaacattttaatgatcaggtgtatgttttacacatgattaggtgtacgtttttaaacatatcactttt |
200 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39682129 |
aaaaagtttttacactgtctacgattgaagtcaaacattttaatgatcaggtgtatgttttacacctgattaggtgtacgtttttaaacatatcactttt |
39682030 |
T |
|
| Q |
201 |
tacacct |
207 |
Q |
| |
|
||||||| |
|
|
| T |
39682029 |
tacacct |
39682023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 148
Target Start/End: Original strand, 27032048 - 27032076
Alignment:
| Q |
120 |
tatgattgaagtcaaacattttaatgatc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27032048 |
tatgattgaagtcaaacattttaatgatc |
27032076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University