View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2038_low_34 (Length: 224)
Name: NF2038_low_34
Description: NF2038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2038_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 67 - 210
Target Start/End: Complemental strand, 10640205 - 10640062
Alignment:
| Q |
67 |
ttttttacttatttgacttactcttacactttcacaatcttcgtgagaccctttggactagagaatgactaacctaactcgttttcagtcgttcttaatt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10640205 |
ttttttacttatttgacttactcttacactttcacaaccttcgtgagaccctttgggctagagaataactaacctaactcgttttcagtcgttcttaatt |
10640106 |
T |
 |
| Q |
167 |
caactacttaaacatcgtccaaacctaatttaattgttggtcgt |
210 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10640105 |
caactacctaaacatcatccaaacctaatttaattgttggtcgt |
10640062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 10640274 - 10640224
Alignment:
| Q |
18 |
gaaacatcgctgcctacaaaacttagtcatgactcgcattattcaactgtt |
68 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
10640274 |
gaaacatcgcggcctacaaaacttagtcatgacttgcattattccactgtt |
10640224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University