View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20391_low_4 (Length: 300)
Name: NF20391_low_4
Description: NF20391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20391_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 2568741 - 2568478
Alignment:
| Q |
1 |
tagaacacaagaactaactctctgattcaatgatagaggaattcatatatttccttaatctgtttgtcacttaccgtgtattttaccgattcttaatcga |
100 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2568741 |
tagaacacaagaattaactctgtgattcaatgatagagaaattcatatatttccttaatctgtttgtcacttaccgcatattttaccgattcttaatcga |
2568642 |
T |
|
| Q |
101 |
catggtgagcatattaccaggaaagagcaaagtgggcgatgagatggtatatacataatcatctcaccccaaactctcacggtgaaggtttaaggcatca |
200 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2568641 |
catggtgagcatatttccacgaaagagcaaagtgggtgatgagatggtatatacataatcatctcaccccaaactctcacggtgaaggtttaaggcatca |
2568542 |
T |
|
| Q |
201 |
acaacctttggcttgtgaacattgattaccacttagtgattgttgtcccttggatcctcatatt |
264 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2568541 |
acaacctttggtttgtgaacattgattaccacttagtgatcgttgtcccttggatcctcatatt |
2568478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University