View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20391_low_6 (Length: 223)
Name: NF20391_low_6
Description: NF20391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20391_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 8354642 - 8354841
Alignment:
| Q |
1 |
aaagagactcaagaaatgttggatgtttgtgggaagcataatatcacatgtgacattgaattaatcaaagctgatacaatcaatgaagcttttcagcgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8354642 |
aaagagactcaagaaatgttggatgtttgtgggaagcataatatcacatgtgacattgaattaatcaaagctgatacaatcaatgaagcttttcagcgtc |
8354741 |
T |
|
| Q |
101 |
ttgtgaagaatgatgttcgttaccgttttgtcattgacattgctaatgcttcccctgc-----aacctaaaaccttttgctttgggaatgatagatatat |
195 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
8354742 |
ttttgaagaatgatgttcgttaccgttttgtcattgacattgctaatgcttcccctgcaacctaacctaaaaccctttgctttgggaatgatatatatat |
8354841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University