View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20392_high_32 (Length: 250)
Name: NF20392_high_32
Description: NF20392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20392_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 42758625 - 42758859
Alignment:
| Q |
1 |
agatgttcaaactcaacaatcaatcccatatcagggaatttgtcgatcttagggactttagtgttaaaattcataatccaaaagatgttattattaagga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42758625 |
agattttcaaactcaacaatcaatcccaaatcagggaatttgtcgatcttaaggactttagtgttaaaattcataatccaaaagatgttattattaagga |
42758724 |
T |
 |
| Q |
101 |
-gtattcttgcatgtccccatcctttaatcctaggaatttattcttctcttaatgcatagattattggtaccatgagtgcactggaaatttctcatcaaa |
199 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42758725 |
agtattcttgcatctccctatcctttaatcctaggaatttattcttctcttaatgcatagattattggtaccatgagtgcactggaaatttctcatcaaa |
42758824 |
T |
 |
| Q |
200 |
gtggttgggttcatctttggttggagtgtgattct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42758825 |
gtggttgggttcatctttggttggagtgtgattct |
42758859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University