View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20392_high_34 (Length: 245)
Name: NF20392_high_34
Description: NF20392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20392_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 21269401 - 21269616
Alignment:
| Q |
13 |
gaagaatatgattttaatgtgtttaggagtgcttgaaatgaaagttgataaagagaaagataatgtgactgtgaagggtgcaatggatgtgaaaaagcta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21269401 |
gaagaatatgattttaatgtgtttaggagtgcttgaaatgaaagttgataaagagaaagataatgtgactgtgaagggtacaatggatgtgaaaaagcta |
21269500 |
T |
|
| Q |
113 |
gttgagaatttatcagagaagcttaagagaaaggttgaggtagttcaaccaaagaaagacaaagaaggtggtggtggtgagaaagaaggaaatgaaggag |
212 |
Q |
| |
|
|| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21269501 |
gtagagaatttatcacagaagctaaagagaaaggttgaggtagttcaaccaaagaaagacaaagaaggtggtggtggtgagaaagaaggaaatgaaggtg |
21269600 |
T |
|
| Q |
213 |
gaggtgggggtaagaa |
228 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
21269601 |
gtggtgggggtaagaa |
21269616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University