View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20392_high_37 (Length: 237)
Name: NF20392_high_37
Description: NF20392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20392_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43034060 - 43034280
Alignment:
| Q |
1 |
acacttcaacattcttgagaagtgtgaaaacgaacttaaccatgaaaatttacatacagttgttttgaaactattccatggattcagtggaagcaacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43034060 |
acacttcaacattcttgagaagtgtgaaaatgaactaaaccatgaaaatttacatacagttgttttgaaactattccatggattcaatggaagcaacata |
43034159 |
T |
 |
| Q |
101 |
aaaagtcacagtctaaacatttgaaataggaaagnnnnnnnnnngacaatgaaatcatcaacatgatttgcattcaatctttctgtgcagttcaaatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43034160 |
aaaagtcacagtctaaacatttgaaataggaaagaaaaaaaaaagacaatgaaatcatcaacatgatttgcattcaatctttctgtacagttcaaatctt |
43034259 |
T |
 |
| Q |
201 |
ctattcaaaattggatcgaac |
221 |
Q |
| |
|
||||||||| ||| ||||||| |
|
|
| T |
43034260 |
ctattcaaacttgcatcgaac |
43034280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University