View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20392_high_38 (Length: 227)
Name: NF20392_high_38
Description: NF20392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20392_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 40 - 211
Target Start/End: Complemental strand, 51763897 - 51763728
Alignment:
| Q |
40 |
taaactgaaaggcaaccctaacatcactgcatccttcacttcacgactccgcttcctcttctcagtcactgatggaaggaacaagccaaaccggaaccct |
139 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51763897 |
taaactgaaagccaaccctaacatcactgcatccttcacttcacgactctgcttcttcttctcagtcactgatggaaggaacaagccaaaccggagccct |
51763798 |
T |
|
| Q |
140 |
aacaccactgcctcttccgtttgatctcgtgacagaaattctgtgccggctccccgtgaaacatctccttca |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51763797 |
aacaccaccgcctcttccgtttgatctcgtgacagaaattctgtgccggct--ccgtgaaacatctccttca |
51763728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 152 - 211
Target Start/End: Original strand, 51857801 - 51857860
Alignment:
| Q |
152 |
tcttccgtttgatctcgtgacagaaattctgtgccggctccccgtgaaacatctccttca |
211 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
51857801 |
tctttcgttcgatctcgtgacagaaattctgtgccagctccccgtgaaaaatctccttca |
51857860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 51382298 - 51382238
Alignment:
| Q |
151 |
ctcttccgtttgatctcgtgacagaaattctgtgccggctccccgtgaaacatctccttca |
211 |
Q |
| |
|
|||||||||| ||||| ||| ||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
51382298 |
ctcttccgttcgatctggtggcagaaatcctgtgcctgctccccgtgaaacacctccttca |
51382238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 51828959 - 51829007
Alignment:
| Q |
163 |
atctcgtgacagaaattctgtgccggctccccgtgaaacatctccttca |
211 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| ||| |||| |
|
|
| T |
51828959 |
atctcgtgacagaaatactgtgcctgctccccgtgaaacacctcattca |
51829007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 211
Target Start/End: Original strand, 51831599 - 51831663
Alignment:
| Q |
147 |
ctgcctcttccgtttgatctcgtgacagaaattctgtgccggctccccgtgaaacatctccttca |
211 |
Q |
| |
|
|||| ||||||||||||||||||| || ||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
51831599 |
ctgcatcttccgtttgatctcgtggtagtaatcctgtgccggctcccagtgaaatttctccttca |
51831663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University