View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20392_low_2 (Length: 618)
Name: NF20392_low_2
Description: NF20392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20392_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 5e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 501 - 609
Target Start/End: Complemental strand, 23329809 - 23329695
Alignment:
| Q |
501 |
aacattttaatatatatgaattatgaatcacaaatatatgcaaacatgacccattctcttgct-------tcttggttacacgaaaatctcaatgattaa |
593 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23329809 |
aacattttaatatatatgaattatgaatcacaaatatatgcaaaaatga-ccattctcttgcttacactctcttggttacacgaaaatctcaatgattaa |
23329711 |
T |
|
| Q |
594 |
tataatgtagaataat |
609 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23329710 |
tataatgtagaataat |
23329695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 23330375 - 23330321
Alignment:
| Q |
17 |
attaagtactaatgtaaaaggcaaaacctactaattttattgaaaacgaatatag |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23330375 |
attaagtactaatgtaaaaggcaaaacctactaattttattgaaaacgaatatag |
23330321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University