View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20392_low_45 (Length: 231)
Name: NF20392_low_45
Description: NF20392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20392_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 93 - 220
Target Start/End: Original strand, 39890197 - 39890324
Alignment:
| Q |
93 |
caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctctattacttgaag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39890197 |
caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctctattacttgaag |
39890296 |
T |
|
| Q |
193 |
ttttgcttctaaaacgacacattttcat |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
39890297 |
ttttgcttttaaaacgacacattttcat |
39890324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 9 - 136
Target Start/End: Original strand, 39890070 - 39890197
Alignment:
| Q |
9 |
taaaactgctattaagccnnnnnnnaatagaaaatattaatatgtaaattgtaatattgatttgaatataaacatttaacttatcaactcttttattacc |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39890070 |
taaaactgctattaagcctttttttaatagaaaatattaatacgttaattgtaatattgatttgaatataaacatttaacttatcaactcttttattacc |
39890169 |
T |
|
| Q |
109 |
tttggtcaaaccaattgaatccaacccc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39890170 |
tttggtcaaaccaattgaatccaacccc |
39890197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University