View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20393_high_9 (Length: 282)
Name: NF20393_high_9
Description: NF20393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20393_high_9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 49 - 282
Target Start/End: Complemental strand, 7157345 - 7157108
Alignment:
| Q |
49 |
cggaaagacgggcacaatttttatagaagtgt---gttattttttagatttactttatattaagaagactaattaaactcttaatccttgaaagagacaa |
145 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7157345 |
cggaaaggcgggcacagtttttatagaagtgttgtgttattttttagatttcctttatattaagaagactatttaaactcttaacccttgaaagagacaa |
7157246 |
T |
|
| Q |
146 |
taagcggtttgctactagcgacactgaggagggcatgacgccaagtagcaatgccgatgagcaaaaccaggttgcttcgtctgatacaccgtcggagaaa |
245 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7157245 |
taagcggtttgctactagcgacaatgaggagggcatgacgccaagtagcaatgctgatgagcaaaaccaggttgcttcgtctgatacaccgttggagaaa |
7157146 |
T |
|
| Q |
246 |
acgtccgccatcatg-aattgagcttctccactgaaac |
282 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
7157145 |
acatccgccatcatgaaattgagcttctccactgaaac |
7157108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University