View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20393_low_11 (Length: 253)
Name: NF20393_low_11
Description: NF20393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20393_low_11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 41 - 253
Target Start/End: Original strand, 31420163 - 31420373
Alignment:
| Q |
41 |
tcacaatatttctaagtaataaacttgttagaagnnnnnnnntacacatggctgaattcacagaaaattttcaaaatattattagaccttcttttccttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31420163 |
tcacaatatttctaagtaataaacttgttagaa--aaaaaaatacacatggctgaattcacagaaaattttcaaaacattattagaccttctttgccttt |
31420260 |
T |
 |
| Q |
141 |
tcttgattctgatcaaagcatggaactattgaatcaattcatggagaattcaaacatgaacatgatgcataatttgatgcctttttcttgtgacagcatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31420261 |
tcttgattctgatcaaagcatggaactattgaatcaattcatggagaattcaaacatgaacatgatgcataatttgatgcctttttcttgtgacagcatc |
31420360 |
T |
 |
| Q |
241 |
ttggaacatcatc |
253 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31420361 |
ttggaacatcatc |
31420373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University