View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20393_low_12 (Length: 248)
Name: NF20393_low_12
Description: NF20393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20393_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 62 - 237
Target Start/End: Complemental strand, 34847566 - 34847390
Alignment:
| Q |
62 |
aagcataagaaatactagatcacaaggatatattgataccttatcttatttgtaagtacttgtgtatggactatactaatacacaccacattgaattcac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847566 |
aagcataagaaatactagatcacaaggatatattgataccttatcttatttgtaagtacttgtgtatggactatactaatacacaccacattgaattcac |
34847467 |
T |
|
| Q |
162 |
ctgattttcctctttcc-nnnnnnnnncaataaaatcataattctatcacacacaaaattaccaattaagagatatt |
237 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
34847466 |
ctgattttcctctttccttctttttgtcaataaaatcataattctatcgcacaaaaaattaccaattaagagatatt |
34847390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 34847627 - 34847590
Alignment:
| Q |
1 |
gacatagtttattcaatgtggatactttttataattga |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847627 |
gacatagtttattcaatgtggatactttttataattga |
34847590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University